Having issues running HaplotypeCaller with ploidy = 1
Greetings! I am running HaplotypeCaller on a haploid data set. It works perfectly leaving the default ploidy at 2, but I get the following error when I set it to 1: INFO 21:05:57,644 HelpFormatter -...
View ArticlePrevent haplotypecaller from using soft-clipped proportion of the read
Dear GATK team, From what I read on the forum, it seems that HaplotypeCaller call variants (and perhaps calculates RGQ) using soft-clipped parts of the reads? Is there a parameter to suppress this...
View ArticleIs Indel realignment necessary when HaplotypeCaller re-assembles all reads in...
If HaplotypeCaller re-assembles all reads in a region Why is it recommend to run IndelRealigner first?
View ArticleHaplotypeCaller Bug? 0,0 AD
Haplotype Caller output this record, how can it have an AD of 0,0? 7 21584892 . T TAA 257.77 . AC=1;AF=0.500;AN=2;DP=118;FS=0.000;MLEAC=1;MLEAF=0.500;MQ=70.00;SOR=4.804 GT:AD:GQ:PL 0/1:0,0:99:125,0,112...
View ArticlePloidy and "Pooled" for the Haplotype Caller
Hello everyone, I was reading the haplotype caller documentation and noticed the "--sample_ploidy/-ploidy" flag. The description reads "Ploidy (number of chromosomes) per sample. For pooled data, set...
View ArticleRelease notes for GATK version 3.4
GATK 3.4 was released on May 15, 2015. Itemized changes are listed below. For more details, see the user-friendly version highlights. New tool ASEReadCounter: A tool to count read depth in a way that...
View ArticleUncorrect Strand Bias due to Downsampling (HaplotypeCaller)
Hi GATK team, Again thanks a lot for the wonderful tools you're offering to the community. I have recently switched from UnifiedGenotyper to Haplotype Caller (1 sample at a time, DNASeq). I was...
View ArticleWhat exactly does the --minReadsPerAlignmentStart flag specify in...
Specifically, what does the 'start' component of this flag mean? Do the reads all have to start in exactly the same location? Alternatively, does the flag specify the total number of reads that must...
View ArticleClik here to view.
False Homozygous Variant call within a repeat?
Hi, I'm hoping you can help resolve the behaviour of HaplotypeCaller with respect to a certain position. Here's the IGV screenshot, with these filters: MQ>30, filter secondaries and dups. The DP is...
View ArticleCalling complex pedigrees with HaplotypeCaller
Hi, I want to use HaplotypeCaller to call families together. I have bam files for each individual in the 4 families I am studying, as well as a ped file describing the pedigree information. The problem...
View ArticleRecommended protocol for bootstrapping HaplotypeCaller and BaseRecalibrator...
I am identifying new sequence variants/genotypes from RNA-Seq data. The species I am working with is not well studied, and there are no available datasets of reliable SNP and INDEL variants. For...
View ArticleClik here to view.
HaplotypeCaller bias AGAINST heterozygous calls
Hello, I am having an issue with haplotypecaller omitting true heterozygotes. Attached is an IGV image of the VCF (top track), de novo reassembled BAM file (middle) and input BAM file (bottom). This...
View ArticleDP for INDEL is more than 100 and AD is 0
Hi all, I have the below INDEL call from GATK-3.3 Haplotype caller. chr17 39190954 . G GCAGCAGCTTGGCTGGCAGCAGCTGGTCTCA 770.52 PASS AC=1;AF=0.500;AN=2;DP=138;...
View ArticleDistribution of RGQ scores
I work with non-human genomes and commonly need the confidence of the reference sites, so I was happy to see the inclusion of the RGQ score in the format field of GenotypeGVCFs. However, I am a little...
View ArticleGenotypeGVCFs sees DP incorrectly in INFO, not FORMAT field
I have a potential bug running GATK GenotypeGVCFs. It complains that there is a DP in the INFO field, but in my haplotypecaller-generated -mg.g.vcf.gz's I do not have a DP in the info, I do have DP in...
View ArticleClik here to view.
I expect to see a variant at a specific site, but it's not getting called
This can happen when you expect a call to be made based on the output of other variant calling tools, or based on examination of the data in a genome browser like IGV. There are several possibilities,...
View Article./. genotype despite DP coverage equal to number of reads in reference AD field
I came across some unusual variants called by HaplotypeCaller running in gvcf mode while working on human WGS data (the example gvcf line can be seen below). The genotype in almost all samples is...
View ArticleAny ploidy goes!
Until now, HaplotypeCaller was only capable of calling variants in diploid organisms due to some assumptions made in the underlying algorithms. I'm happy to announce that we now have a generalized...
View ArticleHaplotype caller for RNA-seq
Hi, I have been running HP for my RNA-seq data java -Xmx16g -jar GenomeAnalysisTK.jar \ -T HaplotypeCaller \ -R $ref \ -I INPUT.bam \ -stand_call_conf 50.0 \ -stand_emit_conf 10.0 \ -o output.vcf my...
View Articlenot all sites emitted with GENOTYPE_GIVEN_ALLELES
I am running HC3.3-0 with the following options (e.g. GENOTYPE_GIVEN_ALLELES): $java7 -Djava.io.tmpdir=tmp -Xmx3900m \ -jar $jar \ --analysis_type HaplotypeCaller \ --reference_sequence $ref \...
View Article